|
Left Crispr |
Right Crispr |
| Crispr ID |
1028458930 |
1028458942 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:91069994-91070016
|
7:91070045-91070067
|
| Sequence |
CCTGTGTTGGCCAAGCTGGTTGC |
CCTCGGCCTCCCAAAATGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 4785, 1: 137085, 2: 283143, 3: 212905, 4: 222031} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|