ID: 1028511012_1028511022

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1028511012 1028511022
Species Human (GRCh38) Human (GRCh38)
Location 7:91626422-91626444 7:91626465-91626487
Sequence CCAAGAACATGGTCCTTGATAGG CATCCACACTCCAGGCAGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!