ID: 1028514027_1028514038

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1028514027 1028514038
Species Human (GRCh38) Human (GRCh38)
Location 7:91656727-91656749 7:91656764-91656786
Sequence CCTTCTGGCTCCCACCACAGCCC GCCGTGGGGCCACCTCACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!