ID: 1028522928_1028522935

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1028522928 1028522935
Species Human (GRCh38) Human (GRCh38)
Location 7:91752448-91752470 7:91752491-91752513
Sequence CCCAGCCAAAGGAGGCAGTGGGA TCTGTGCAACCCACAGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 160, 4: 1442} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!