ID: 1028530702_1028530704

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1028530702 1028530704
Species Human (GRCh38) Human (GRCh38)
Location 7:91835421-91835443 7:91835443-91835465
Sequence CCATAATCCACAAGTAACTGAAA AGAACACCTCCTCTGAAGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!