ID: 1028553451_1028553452

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1028553451 1028553452
Species Human (GRCh38) Human (GRCh38)
Location 7:92097288-92097310 7:92097336-92097358
Sequence CCAGAAGCAAGAACTAGAACGAG TCTGTATCAGAACCTTAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127} {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
25 7:92097288-92097310 CCAGAAGCAAGAACTAGAACGAG - 7:92097336-92097358 TCTGTATCAGAACCTTAATGAGG +