ID: 1028557075_1028557083

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1028557075 1028557083
Species Human (GRCh38) Human (GRCh38)
Location 7:92135840-92135862 7:92135876-92135898
Sequence CCCAACACAAACTGCTTAAAAGG TGTTCGGGGCTCAGACTTTCTGG
Strand - +
Off-target summary No data {0: 9, 1: 14, 2: 16, 3: 25, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!