ID: 1028582682_1028582686

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1028582682 1028582686
Species Human (GRCh38) Human (GRCh38)
Location 7:92423539-92423561 7:92423557-92423579
Sequence CCAGCCTTCCTCTCCAGATGACT TGACTTTCTTCCTCTTATACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 49, 4: 637} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!