ID: 1028585716_1028585723

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1028585716 1028585723
Species Human (GRCh38) Human (GRCh38)
Location 7:92448984-92449006 7:92449019-92449041
Sequence CCTTAGTATTCTGGGGAATGGTC AAGGGAATGAGCTCTGTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93} {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!