ID: 1028602018_1028602023

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1028602018 1028602023
Species Human (GRCh38) Human (GRCh38)
Location 7:92611958-92611980 7:92611982-92612004
Sequence CCATCCACTTCAAAGGAGGGACA AGTGGGAGGCTCCAACCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 149} {0: 1, 1: 0, 2: 2, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!