ID: 1028649666_1028649674

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1028649666 1028649674
Species Human (GRCh38) Human (GRCh38)
Location 7:93137616-93137638 7:93137654-93137676
Sequence CCCACTACCCTGTGGAAAAATTG GTCCCTGGTTCCAAAAAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 301} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!