ID: 1028662919_1028662921

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1028662919 1028662921
Species Human (GRCh38) Human (GRCh38)
Location 7:93302171-93302193 7:93302202-93302224
Sequence CCACTTGAGGTAATTTTTGTATG GCTATGAGCACAGTCACTTTTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 51, 3: 192, 4: 564} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!