ID: 1028706181_1028706185

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1028706181 1028706185
Species Human (GRCh38) Human (GRCh38)
Location 7:93849578-93849600 7:93849599-93849621
Sequence CCAGCAGTGTTTTTCCAAGGGCA CAGTTTTAGGAGAGTGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182} {0: 1, 1: 0, 2: 0, 3: 31, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!