ID: 1028762327_1028762337

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1028762327 1028762337
Species Human (GRCh38) Human (GRCh38)
Location 7:94509888-94509910 7:94509914-94509936
Sequence CCGCGGCCGAGGAGGGGCAGGCG GTCGGGGGCGCCGCGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 267} {0: 1, 1: 0, 2: 3, 3: 56, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!