ID: 1028796309_1028796320

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1028796309 1028796320
Species Human (GRCh38) Human (GRCh38)
Location 7:94907813-94907835 7:94907832-94907854
Sequence CCGGCCGGCACCCCTGGCCCCAG CCAGGCCGGCCCGAGCGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 102, 4: 827} {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!