ID: 1028820216_1028820221

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1028820216 1028820221
Species Human (GRCh38) Human (GRCh38)
Location 7:95200701-95200723 7:95200735-95200757
Sequence CCTGTTTTTGTAAAGTAATCAGA AGCAGATATTTTCAGGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!