ID: 1028839499_1028839504

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1028839499 1028839504
Species Human (GRCh38) Human (GRCh38)
Location 7:95412661-95412683 7:95412704-95412726
Sequence CCTGAAAATAACTGAAAAGAAGA GAGAGTAATCAGAAGGTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 82, 4: 889} {0: 1, 1: 0, 2: 1, 3: 14, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!