ID: 1028845308_1028845314

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1028845308 1028845314
Species Human (GRCh38) Human (GRCh38)
Location 7:95473419-95473441 7:95473469-95473491
Sequence CCTGGCTGTGAGAGCCACAGGTT AGTTCCCAGCGGAGCCTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!