ID: 1028850055_1028850061

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1028850055 1028850061
Species Human (GRCh38) Human (GRCh38)
Location 7:95527942-95527964 7:95527957-95527979
Sequence CCCACATGGAGACCCCCCTGGCC CCCTGGCCATCGCCGCCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 318} {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!