ID: 1028872710_1028872725

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1028872710 1028872725
Species Human (GRCh38) Human (GRCh38)
Location 7:95786761-95786783 7:95786812-95786834
Sequence CCATCCTCCTTCCCCTTGGCCCC TGTAGCAGGGACTGGAGCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 24, 3: 63, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!