ID: 1028884122_1028884129

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1028884122 1028884129
Species Human (GRCh38) Human (GRCh38)
Location 7:95912335-95912357 7:95912380-95912402
Sequence CCCACTTGAACATCTTGATGCTA CTGGAGTGAAGGAGTTTATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 106} {0: 1, 1: 0, 2: 3, 3: 18, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!