ID: 1028896576_1028896583

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1028896576 1028896583
Species Human (GRCh38) Human (GRCh38)
Location 7:96048302-96048324 7:96048349-96048371
Sequence CCTGAATCTGACATTCAAAGCTG TAGAGCAGGTGAACAGATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!