ID: 1028898560_1028898566

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1028898560 1028898566
Species Human (GRCh38) Human (GRCh38)
Location 7:96069570-96069592 7:96069607-96069629
Sequence CCAGTTTTGAATGAGAACCTTGG CATGAAAATCATGCCAGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169} {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!