ID: 1028937650_1028937654

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1028937650 1028937654
Species Human (GRCh38) Human (GRCh38)
Location 7:96484203-96484225 7:96484246-96484268
Sequence CCAGAGGTTATGCCCTACAGAGT TACATTCTCCTTCCTGCCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 34, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!