ID: 1028944972_1028944978

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1028944972 1028944978
Species Human (GRCh38) Human (GRCh38)
Location 7:96569154-96569176 7:96569192-96569214
Sequence CCAATAAGGATGTGATGATATTA GAAGTCAGTCTTGATTCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!