ID: 1028946770_1028946776

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1028946770 1028946776
Species Human (GRCh38) Human (GRCh38)
Location 7:96589057-96589079 7:96589082-96589104
Sequence CCTCTGATGATGGCTATTGCCTG TGAAGGCTGCACCCAGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!