ID: 1028950451_1028950454

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1028950451 1028950454
Species Human (GRCh38) Human (GRCh38)
Location 7:96629850-96629872 7:96629868-96629890
Sequence CCATGCCCAATAATGCAGTGGTT TGGTTCCTCCAGACTCATAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 120, 3: 267, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!