ID: 1028977463_1028977466

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1028977463 1028977466
Species Human (GRCh38) Human (GRCh38)
Location 7:96930016-96930038 7:96930043-96930065
Sequence CCTGTCTCCCTCTATTTATTCTA TGATCTAAATACCACTTGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!