ID: 1029028173_1029028177

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1029028173 1029028177
Species Human (GRCh38) Human (GRCh38)
Location 7:97440084-97440106 7:97440107-97440129
Sequence CCTTGCATGGGCTTATCTCATAA CCTTCACTACGGTGCCTAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 14, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!