ID: 1029044557_1029044563

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029044557 1029044563
Species Human (GRCh38) Human (GRCh38)
Location 7:97614016-97614038 7:97614067-97614089
Sequence CCTACGCCCACGGAATCGCGCTG CTGCAAGGCGGCAACGAGGCTGG
Strand - +
Off-target summary No data {0: 315, 1: 1152, 2: 1845, 3: 1595, 4: 741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!