ID: 1029054925_1029054943

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1029054925 1029054943
Species Human (GRCh38) Human (GRCh38)
Location 7:97732203-97732225 7:97732251-97732273
Sequence CCCGCGCGGTGCTGGCCGCGGCT GTCCGAGGTGGCCGCGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 136} {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!