ID: 1029061052_1029061056 |
View in Genome Browser |
Spacer: 17 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1029061052 | 1029061056 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:97798222-97798244 | 7:97798262-97798284 |
Sequence | CCTGGAGTTGGACCGCCAGGGTT | ACCTATTAGCTGTTTAACACTGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |