ID: 1029085990_1029086002

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1029085990 1029086002
Species Human (GRCh38) Human (GRCh38)
Location 7:98012187-98012209 7:98012237-98012259
Sequence CCTGGGCTTCAGCGATCCTCCCA CAGGTGTGCACCACCGCACCTGG
Strand - +
Off-target summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889} {0: 41, 1: 1897, 2: 11282, 3: 52258, 4: 136533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!