ID: 1029099229_1029099239

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1029099229 1029099239
Species Human (GRCh38) Human (GRCh38)
Location 7:98114623-98114645 7:98114645-98114667
Sequence CCCCTGTCTCCCTGCATCTGGTG GAAGGGAGACGGTCGCATCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 520} {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!