ID: 1029099230_1029099239

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029099230 1029099239
Species Human (GRCh38) Human (GRCh38)
Location 7:98114624-98114646 7:98114645-98114667
Sequence CCCTGTCTCCCTGCATCTGGTGA GAAGGGAGACGGTCGCATCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 251} {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!