ID: 1029099517_1029099525

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1029099517 1029099525
Species Human (GRCh38) Human (GRCh38)
Location 7:98117091-98117113 7:98117117-98117139
Sequence CCTGTAAAGTTACTCTGTCCTCC CCCCATGGTGTACGAGTGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!