ID: 1029103187_1029103193

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1029103187 1029103193
Species Human (GRCh38) Human (GRCh38)
Location 7:98151589-98151611 7:98151641-98151663
Sequence CCCCTGTGGCAGCGTGGGGGCGT TTTCCAGAAAGGATGTCTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133} {0: 1, 1: 1, 2: 0, 3: 20, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!