ID: 1029105465_1029105469

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1029105465 1029105469
Species Human (GRCh38) Human (GRCh38)
Location 7:98171666-98171688 7:98171697-98171719
Sequence CCTGCACAGGTGGGTACCTGCGT CACGCCCCACACAGCACCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96} {0: 1, 1: 0, 2: 6, 3: 4, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!