ID: 1029106036_1029106039

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1029106036 1029106039
Species Human (GRCh38) Human (GRCh38)
Location 7:98176897-98176919 7:98176924-98176946
Sequence CCAACTCTTAAGTGGTAGTGCTG TCCCGTCTGTGTTACAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!