ID: 1029110874_1029110886

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029110874 1029110886
Species Human (GRCh38) Human (GRCh38)
Location 7:98212447-98212469 7:98212482-98212504
Sequence CCGGGCCGCAGCAAGGGCTCCGG GCAGGCGGCCAGGACCCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196} {0: 1, 1: 1, 2: 2, 3: 28, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!