ID: 1029111426_1029111439

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1029111426 1029111439
Species Human (GRCh38) Human (GRCh38)
Location 7:98214734-98214756 7:98214758-98214780
Sequence CCAGCGCAGCCCAGGGCTTCCTG GGGGCAGCAGGAGTGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 53, 4: 427} {0: 1, 1: 0, 2: 5, 3: 68, 4: 1372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!