ID: 1029112067_1029112074

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1029112067 1029112074
Species Human (GRCh38) Human (GRCh38)
Location 7:98217599-98217621 7:98217627-98217649
Sequence CCCAGGGGACAGTCCCACAGTGG CCGTCTTCAGCACCCAGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144} {0: 1, 1: 0, 2: 1, 3: 23, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!