ID: 1029112143_1029112156

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029112143 1029112156
Species Human (GRCh38) Human (GRCh38)
Location 7:98217912-98217934 7:98217933-98217955
Sequence CCGATACCCCCTGAGCACCCCCA CACCTGGTCCAGGGGCCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 273} {0: 1, 1: 0, 2: 4, 3: 38, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!