ID: 1029112255_1029112262

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1029112255 1029112262
Species Human (GRCh38) Human (GRCh38)
Location 7:98218310-98218332 7:98218335-98218357
Sequence CCGGCCTCCTGATCCTCTTTCTG GAGGCAGAAACTATGGACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 574} {0: 1, 1: 0, 2: 1, 3: 27, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!