ID: 1029114106_1029114114

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1029114106 1029114114
Species Human (GRCh38) Human (GRCh38)
Location 7:98228657-98228679 7:98228690-98228712
Sequence CCCGTTTCAGTGTCTGTTTCCGC CAGTAGGAACAGAGGGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187} {0: 1, 1: 0, 2: 1, 3: 21, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!