ID: 1029116646_1029116660

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1029116646 1029116660
Species Human (GRCh38) Human (GRCh38)
Location 7:98241119-98241141 7:98241169-98241191
Sequence CCAGAGTGTGGCCCACAGGAGGT CCTCCCCGGGGGTGTCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 214} {0: 1, 1: 0, 2: 20, 3: 19, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!