ID: 1029123200_1029123214

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1029123200 1029123214
Species Human (GRCh38) Human (GRCh38)
Location 7:98281739-98281761 7:98281767-98281789
Sequence CCCGCCGGGGCCGACCGAGCCGA GCCGGAGCGGCGGGCGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 68} {0: 1, 1: 3, 2: 22, 3: 131, 4: 921}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!