ID: 1029129221_1029129227

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1029129221 1029129227
Species Human (GRCh38) Human (GRCh38)
Location 7:98317584-98317606 7:98317601-98317623
Sequence CCCTCATCCCTCAGTTCACACCG ACACCGTCTGCATGCTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 166} {0: 1, 1: 2, 2: 5, 3: 9, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!