ID: 1029149909_1029149918

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029149909 1029149918
Species Human (GRCh38) Human (GRCh38)
Location 7:98472530-98472552 7:98472551-98472573
Sequence CCCAGCACGTTGGCTGCACCCAG AGGAGCAGCTGCGGGGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!