ID: 1029162378_1029162382

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1029162378 1029162382
Species Human (GRCh38) Human (GRCh38)
Location 7:98561793-98561815 7:98561810-98561832
Sequence CCACTGGCTCTACCACCAAAGGG AAAGGGAGATTGACTGAGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!